View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5108-Insertion-5 (Length: 123)
Name: NF5108-Insertion-5
Description: NF5108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5108-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 3923765 - 3923880
Alignment:
| Q |
8 |
gtagtaacaaatcgtctgcttgaatcacagtgacctttacatacctaagggaaggtgacatatataccttagaacgagtatagcaaacagaatcatcagt |
107 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923765 |
gtagtaacaaatggtgtgcttgaatcacagtgacctttacatacctaagggaaggtgacatatataccttagaacgagtatagcaaacagaatcatcagt |
3923864 |
T |
 |
| Q |
108 |
tatctctgttgtatct |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3923865 |
tatctctgttgtatct |
3923880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University