View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5108_low_1 (Length: 344)
Name: NF5108_low_1
Description: NF5108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5108_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 107 - 339
Target Start/End: Original strand, 2054855 - 2055102
Alignment:
| Q |
107 |
gttgcaaaatatttaagtgaagtatgtggtatatatcnnnnnnnaagcaatatttataacatgttttacttacttgttgtacttaaaagaataataaaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2054855 |
gttgcaaaatatttaagtgaagtatgtggtatatatctttttttaagcaatatttataacatgttttacttacttgttgtacttaaaagaataataaaca |
2054954 |
T |
|
| Q |
207 |
attaaaggtataacag-aaaagtgatattgatg--------------taaaacgacttataatcaaagataattttcacctatatcattttataatttag |
291 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
2054955 |
attaaaggtataacagaaaaaattatattgatgttatattgttattataaaacgacttataatcaaagataattttctcctatagcattttataatttag |
2055054 |
T |
|
| Q |
292 |
gacaggtcgagtcgattattatttttacaaacacggtagtattattta |
339 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2055055 |
gacagatcgagtcgattattatttttacaaacacggtagtattattta |
2055102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 2054766 - 2054794
Alignment:
| Q |
18 |
aagattcactcatatatactttatcacaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2054766 |
aagattcactcatatatactttatcacaa |
2054794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University