View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110-Insertion-11 (Length: 148)
Name: NF5110-Insertion-11
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110-Insertion-11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 4e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 17914047 - 17913944
Alignment:
| Q |
8 |
gagacatggcggagggattaactaggagaagggagaatttgctatgaagaagagagtaagagagaagcgcgaataaggaaggtatatatatgattagggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17914047 |
gagacatggcggagggattaactaggagaagggagaatttgctat---gacgagagtaagagagaagcgcgaacaaggaagg----tatatgattagggt |
17913955 |
T |
|
| Q |
108 |
tttcaaagttt |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
17913954 |
tttcaaagttt |
17913944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University