View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_106 (Length: 223)
Name: NF5110_high_106
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_106 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 27448430 - 27448642
Alignment:
| Q |
10 |
ttgactccaacttttctttgattcatgctttttctctagcacatggtgatgctgttgcttcaacacaatactctctatccttcaaggtaaaaaacattct |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448430 |
ttgactcaaacttttctttgattcatgctttttcattagcgcatggtgatgctgttgcttcaacacaatactctctatccttcaaggtaaaaaacattct |
27448529 |
T |
 |
| Q |
110 |
atgctttgtttacttctaaggaaatatctaaaaataatcgattggttatttttgtgatggcagagaaatctaagagatgttgctgcgttgtatggatgcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27448530 |
atgctttgtttacttctaaggaaatatctaaaaa-aattgattggttatttttgtgatggcagagaaatctaagagatgttgctgagttgtatggatgcg |
27448628 |
T |
 |
| Q |
210 |
agccaactttggaa |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27448629 |
agccaactttggaa |
27448642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 97
Target Start/End: Original strand, 27423172 - 27423254
Alignment:
| Q |
15 |
tccaacttttctttgattcatgctttttctctagcacatggtgatgctgttgcttcaacacaatactctctatccttcaaggt |
97 |
Q |
| |
|
|||||||| |||| |||||| | |||||| |||||||||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27423172 |
tccaacttgccttttattcattccttttctgaagcacatggtgatgctcttgcttcttcacaacactctctatccttcaaggt |
27423254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 27401088 - 27401155
Alignment:
| Q |
30 |
attcatgctttttctctagcacatggtgatgctgttgcttcaacacaatactctctatccttcaaggt |
97 |
Q |
| |
|
|||||||| |||||| ||| || ||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27401088 |
attcatgccttttctgaagctcaaggtgatgctcttgcttcttcacaacactctctatccttcaaggt |
27401155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University