View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_25 (Length: 426)
Name: NF5110_high_25
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 24 - 409
Target Start/End: Original strand, 30412502 - 30412887
Alignment:
| Q |
24 |
aacccgatgttaaactgaaccggttccggttcaaacctgttagtaaaccgctggttcaaaaactcagctcgacccgctggatcgtaaaagaaaactggca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412502 |
aacccgatgttaaactgaaccggttccggttcaaacctgttagtaaaccgctggttcaaaaactcagctcgacccgctggatcgtaaaagaaaactggca |
30412601 |
T |
 |
| Q |
124 |
ccattccatcaacagcaccggcaccagcaccagcaaacggcatgatctgttgctgaatcgagagaaaagggaaccgatccatgacgctaccgccggtggg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412602 |
ccattccatcaacagcaccggcaccagcaccagcaaacggcatgatctgttgctgaatcgagagaaaagggaaccgatccatgacgctaccgccggtggg |
30412701 |
T |
 |
| Q |
224 |
aacttctcggcgcgtgacctcacgctcaggagcagggacagatgattcaacggtgctgctttggctagggctatcttctttgacatcggaaggaggagga |
323 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412702 |
aacttctcggcgcgtgacctcacggtcaggagcagggacagatgattcaacggtgctgctttggctagggctatcttctttgacatcggaaggaggagga |
30412801 |
T |
 |
| Q |
324 |
gggaagttggttttggcttttgggccacggaactgacgagcggcgttgtcgtaagctctggcagcttcttcggcggtgtcaaaggt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412802 |
gggaagttggttttggcttttgggccacggaactgacgagcggcgttgtcgtaagctctggcagcttcttcggcggtgtcaaaggt |
30412887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 267 - 297
Target Start/End: Original strand, 4068047 - 4068077
Alignment:
| Q |
267 |
gattcaacggtgctgctttggctagggctat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4068047 |
gattcaacggtgctgctttggctagggctat |
4068077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University