View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_44 (Length: 342)
Name: NF5110_high_44
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_44 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 180 - 342
Target Start/End: Complemental strand, 38997274 - 38997114
Alignment:
| Q |
180 |
aagagattgttggatcaccggttgatccgtatgactgaatctaagtaactcagtcgtatatcttggcgtctacaaaaaagattgtatcactaaaccagat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
38997274 |
aagagattgttggatcaccggttgatccgtatgactgaatctaagtaactcagtcgtatatcttggcgtctacaaaaaagattgtatcac--aaccaaat |
38997177 |
T |
|
| Q |
280 |
tgaaccgaaacataacttcacaactaaaggcataaacagaggcaaaaactaaagatagacata |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38997176 |
tgaaccgaaacataacttcacaactaaaggcataagcagaggcaaaaactaaagatagacata |
38997114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University