View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_52 (Length: 307)
Name: NF5110_high_52
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 86 - 301
Target Start/End: Original strand, 22640399 - 22640614
Alignment:
| Q |
86 |
agacatgaaattcatactcaaccagtttgagagatttatatctttgctagagttgcattgtagcaatatggtttctcgcaaaaatattaaaagtttagat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22640399 |
agacatgaaattcatactcaaccagtttgagagatttatatctttgctagagttgcattgtagcactatggtttctcgcaaaaatattaaaagtttagat |
22640498 |
T |
 |
| Q |
186 |
ttcaaaagttggttgctttcagaaattagaggtttctctataaggatttggctactcttgaatgggaccaatttgcaagtgaatgttattaaagagaatt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
22640499 |
ttcaaaagttggttgctttcagaaattagaggtttctctataaggatttggctactcttgaatgggaccaatttgcaagtgaatgttattcaagagagtt |
22640598 |
T |
 |
| Q |
286 |
tttatttgttcatatc |
301 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22640599 |
tttatttgttcatatc |
22640614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University