View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_54 (Length: 302)
Name: NF5110_high_54
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 13 - 281
Target Start/End: Original strand, 3128747 - 3129015
Alignment:
| Q |
13 |
agtacagacatacgaggaagttgtcgagttgttgacgatcatgaggcgaaagagaatgagtttgttgagatatataagatcgtagaagatgatgagattg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3128747 |
agtaaagacatacgaggaagttgtcgagttgttgacgatcatgaggcgaaagagaatgagtttgttgagagatataagatcgtagaagatgatgagattg |
3128846 |
T |
 |
| Q |
113 |
agataactgagcatcaatcaatggtaactgatctataggagtagcaactcgaagacatgctacatgtgcagacagaagctgttcatacaaaggatgtgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3128847 |
agataactgagcatcaatcaatggtaactgatctataggagtagcaactcgaagacatgctacatgtgcagacagaagctgttcatacaaaggatgtgtt |
3128946 |
T |
 |
| Q |
213 |
gctatctccgccttcagttgtctgttctcaccgccaccatctccgccgtaaacaccaccaccaccctgc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
3128947 |
gctatctccgccttcagttgtctgttctcaccgccaccatctccgccgtaaccaccaccactaccctgc |
3129015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University