View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_55 (Length: 299)
Name: NF5110_high_55
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 106 - 197
Target Start/End: Complemental strand, 31408576 - 31408492
Alignment:
| Q |
106 |
ataccatagttattgttactgcacattaattagtagtggccatctatgactttttggtgtgattcatttgaaatatgtcttattgtgtttta |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
31408576 |
ataccataattattgttactgcacatta-------gtggccatctatgactttttggtgtgattcatttgatatatgtcttattatgtttta |
31408492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 48
Target Start/End: Complemental strand, 31408664 - 31408634
Alignment:
| Q |
18 |
aactcttctctgcaatggtaaaatatacgat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31408664 |
aactcttctctgcaatggtaaaatatacgat |
31408634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University