View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_66 (Length: 265)
Name: NF5110_high_66
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 38996904 - 38997143
Alignment:
| Q |
19 |
attttcacagaggctttgaatttctgtttgattttggttgctataaaattgatgacttgtttgggtcttagggtgggttatttgtgttttgataaattta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38996904 |
attttcacagaggctttgaatttctgtttgattttggttgttataaaattgatgacttgtttgggttttagggtgggttatttgtgttttgataaattta |
38997003 |
T |
 |
| Q |
119 |
ataatttttctctaactgtggttgaaaattattctgtgttttaatttggttgttatactgttatactatgttgtgctttgcatatgtatattgttattta |
218 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997004 |
ataatttttctctaactatggtttaaaattattctgtgttttaatttggttgttatactgttatactatgttgtgctttgcatatgtatattgttattta |
38997103 |
T |
 |
| Q |
219 |
ggtttctgtttatgtctatctttagtttttgcctatgctt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38997104 |
ggtttctgtttatgtctatctttagtttttgcctctgctt |
38997143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University