View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_69 (Length: 257)
Name: NF5110_high_69
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 27448879 - 27449034
Alignment:
| Q |
1 |
catttgtatctatgaaacgctgacacagataccaaacatgatactcatagttaaacaagtagcattgatgcttaacgggatttgcagttggtatatcagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| | |
|
|
| T |
27448879 |
catttgtatctatgaaacgctgacacagataccaaacatgatactcatagttaaacaagtagcattgatgcttaatgtgatttgcagttggtatatccat |
27448978 |
T |
|
| Q |
101 |
caacaacttagatttgttgtcgaaaaagttattgttcaaattacacaattgttcta |
156 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448979 |
caaccacttagatttgttgtcgaaaaagttattgttcaaattacacaattgttcta |
27449034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University