View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_77 (Length: 250)
Name: NF5110_high_77
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 43811319 - 43811097
Alignment:
| Q |
18 |
ctgattgatgttgtcatcaaactgcactatgactaccacacctacacactcacgaacgctaatcaaattattcctccaccaccctacttattgtaatcaa |
117 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43811319 |
ctgattgatgttgtcatcaaactaaattatgactaccacacctacacactcacgaacgctaatcaaattattcctccaccaccctacttattgtaatcaa |
43811220 |
T |
|
| Q |
118 |
acca-atttcgaccgccacacatacaccctcacaaatgctatcaaattatcccatcatgtagaacctcccccctcccaccatcgctaataccccctactt |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43811219 |
accacatttcgaccgccacacatacaccctcacaaatactatcaaattatcccaccatgcagaacctcccccctcccaccatcgctaataccccctactt |
43811120 |
T |
|
| Q |
217 |
caccatgcgtgactgttagaatt |
239 |
Q |
| |
|
|||||||| |||||| ||||||| |
|
|
| T |
43811119 |
caccatgcctgactgctagaatt |
43811097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University