View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_78 (Length: 250)
Name: NF5110_high_78
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_78 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 42298087 - 42298329
Alignment:
| Q |
8 |
gagatgaatgacataccttgatgaagcacaaatattcggtcgacaaaaacttaaagaaggtttcattaaatttggccaaatctttgctctaccattgtga |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42298087 |
gagaagaatgacataccttgatgaagcacaaatattcggtcgacaaaaacttaaagaaggtttcattaaatttggccaaatctttgctctaccattatga |
42298186 |
T |
 |
| Q |
108 |
aaaagtcaatgttgtcttttctcatttatcccttcatgttttgctcaccattatccatgttcgctctaagggtcccagacatcaggagccactgcagctc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
42298187 |
aaaagtcaatgttgtcttttctcatttattccttcatgttttgctcaccattatccatgttcgctctaagggtcccagacatcaggagctaatgcagctc |
42298286 |
T |
 |
| Q |
208 |
cttcgatatgaattaattgaagtcattaactctttcatgtctc |
250 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42298287 |
ctccgatatgaattaattgaagtcattaactctttcatgtctc |
42298329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University