View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_high_79 (Length: 248)
Name: NF5110_high_79
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_high_79 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 248
Target Start/End: Original strand, 27963679 - 27963897
Alignment:
| Q |
14 |
ttcttatcggttcttttgaaggtctcatcggttatggtgttcaatggcttgttgttggtcaatacattcaaccccttccttattggcaggtaatattgct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27963679 |
ttcttatcggttcttttgaaggtctcatcggttatggtgttcaatggcttgttgttggtcaatacattcaaccccttccttattggcaggtaatattgct |
27963778 |
T |
 |
| Q |
114 |
agtcactttttcctcttaatcaattaatacttacattcttagaaagatttagcaaattagtcctcacattcagacaaatttggactgaattgggtcgcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27963779 |
agtcactttttcctcttaatcaattaatac----------------atttagcaaattagtcctgacattcagacaaatttggactgaattgggtcccaa |
27963862 |
T |
 |
| Q |
214 |
gaaaattggatctttagtattaatcttgattaatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27963863 |
gaaaattggatctttagtattaatcttgattaatt |
27963897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University