View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_111 (Length: 218)
Name: NF5110_low_111
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 7 - 142
Target Start/End: Complemental strand, 33983504 - 33983369
Alignment:
| Q |
7 |
atttattcctctaccctgtcatgtatgcatgcttgacattgctgtctact-tttaagtcaacttttatgtttgttaactgcttgatcatgaggattcatt |
105 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33983504 |
atttattcctctacc-tgtcatgtatgcatgcttgacattgctgtctactctttaagtcaacttttatgtttgttaactgcttgatcatgaggattcatt |
33983406 |
T |
 |
| Q |
106 |
ttgaatatcatcctcttgtttgcttatttatttattt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33983405 |
ttgaatatcatcctcttgtttgcttatttatttattt |
33983369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 54534989 - 54535028
Alignment:
| Q |
175 |
gtaaatcgtccatgtatgtccgcgtgtttttggttttcgt |
214 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
54534989 |
gtaaatcgtccatgtaagttcgcgtgtttttggttttcgt |
54535028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University