View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5110_low_111 (Length: 218)

Name: NF5110_low_111
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5110_low_111
NF5110_low_111
[»] chr1 (1 HSPs)
chr1 (7-142)||(33983369-33983504)
[»] chr4 (1 HSPs)
chr4 (175-214)||(54534989-54535028)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 7 - 142
Target Start/End: Complemental strand, 33983504 - 33983369
Alignment:
7 atttattcctctaccctgtcatgtatgcatgcttgacattgctgtctact-tttaagtcaacttttatgtttgttaactgcttgatcatgaggattcatt 105  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
33983504 atttattcctctacc-tgtcatgtatgcatgcttgacattgctgtctactctttaagtcaacttttatgtttgttaactgcttgatcatgaggattcatt 33983406  T
106 ttgaatatcatcctcttgtttgcttatttatttattt 142  Q
    |||||||||||||||||||||||||||||||||||||    
33983405 ttgaatatcatcctcttgtttgcttatttatttattt 33983369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 54534989 - 54535028
Alignment:
175 gtaaatcgtccatgtatgtccgcgtgtttttggttttcgt 214  Q
    |||||||||||||||| || ||||||||||||||||||||    
54534989 gtaaatcgtccatgtaagttcgcgtgtttttggttttcgt 54535028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University