View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_112 (Length: 217)
Name: NF5110_low_112
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_112 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 36530250 - 36530152
Alignment:
| Q |
1 |
ttctagggtggaaaaatggatggatttggattgaataaaaaa-cctagatttatatcgagaaaaactcagttttggtttataccttttggattaaccct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36530250 |
ttctagggtggaaaaatggatggatttggattgaataaaaaaacctagatttatatcgagaaaaactcagttttggtttataccttttggattaaccct |
36530152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 145 - 203
Target Start/End: Complemental strand, 36530105 - 36530047
Alignment:
| Q |
145 |
ttgtgattgggaggtataaagcaacgaagaagacgaagatgaagaaaagagaacttact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
36530105 |
ttgtgattgggaggtataaagcaacgaagaagacgaagacgaagagaagagaacttact |
36530047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University