View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_52 (Length: 309)
Name: NF5110_low_52
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 15 - 291
Target Start/End: Original strand, 32664745 - 32665021
Alignment:
| Q |
15 |
tatgtctaagagaaaccaattagcagaacatgcgaaaagatcgctaccgtgtcgccacaagaattctcttgaaagaagagggtaggcagcatttgtggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32664745 |
tatgtctaagagaaaccaattagcagaacatgcgaaaagatcgcgaccgtgtcgccacaagaattctcttgaaagaagagggtaggcaacatttgtggct |
32664844 |
T |
|
| Q |
115 |
ggtggtaatggatgctcttcggttatttggctcattgagacatctagtactttctccatgtcttttgcagcttgcaacacattttgttccactaatgctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32664845 |
ggtggtaatggatgctcttcggttatttggctcattgagacatctagtactttctccatgtcttttgcagcttgcaacacattttgttccactaatgctg |
32664944 |
T |
|
| Q |
215 |
tatacctaatgcacacaccatagtacgttattaaattgtttgtcaaagccatgaacattaaaaatgcaatgaatttg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32664945 |
tatacctaatgcacacaccatagtacgttattaaattgtttgtcaaagccatgaacattaaaaatgcaatgaatttg |
32665021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University