View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_58 (Length: 298)
Name: NF5110_low_58
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 45267948 - 45267827
Alignment:
| Q |
1 |
aaaaaactattgcattggacaactcacaaattttctggtaacagtatttgcctgcttcacattcatcaacctgaccttgtcaattccttcagtgagtcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45267948 |
aaaaaactattgcattggacaactcacaaattttctggtaacagtatttgccttcttcacattcatcaacctgaccttgtcaattccttcagtgagtcac |
45267849 |
T |
|
| Q |
101 |
actctctcttcaattctcccac |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45267848 |
actctctcttcaattctcccac |
45267827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 152 - 281
Target Start/End: Complemental strand, 45267797 - 45267667
Alignment:
| Q |
152 |
atgatcatcacataactgtctttgttggtgtggtggtttaattgatcaatttattgtttgcttgttggattcagtggttgtgaattttggatttaggcaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45267797 |
atgatcatcacataactgtctttgttggtgtggtggtttaattgatcaatttattgtttgcttgttggattcagtggttgcgaattttggatttaggcaa |
45267698 |
T |
|
| Q |
252 |
ttttggat-aacaacttaattaagcacttat |
281 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| |
|
|
| T |
45267697 |
ttttggataaacatcttaattaagcacttat |
45267667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University