View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_65 (Length: 279)
Name: NF5110_low_65
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 27964186 - 27964447
Alignment:
| Q |
1 |
cggtagcaaaaaccaccaccgcagctgaagacagcgaagaaagtaagtatttcggtatctgcaacgccgtcgcggttgtgctcgccgtttatctcttagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27964186 |
cggtagcaaaaaccaccaccgcagctgaagacagtgaagaaagtaagtatttcggtatctgcaacgccgtcgccgttgtgctcgccgtttatctcttagc |
27964285 |
T |
 |
| Q |
101 |
ttatggttttgtacctaatgctaatacacttgtatcaagagttttcgttgctgttttgcttgttctcttggcttccccattgggaataccgatttatgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||| |||||||| |
|
|
| T |
27964286 |
ttatggttttgtacctaatgctaatacacttgtatcaagagttttcgttgctgttttgcttgttcttttggcatcaccattggggataccggtttatgca |
27964385 |
T |
 |
| Q |
201 |
tatttcaagggtagaaattcgggtcgggttggtggtgatgtagagggtcaaagggttagaga |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27964386 |
tatttcaagggtagaaattcgggtcgggatggtggtgatgtagagggtcaaagggttagaga |
27964447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University