View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_69 (Length: 261)
Name: NF5110_low_69
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 6 - 124
Target Start/End: Complemental strand, 31069313 - 31069196
Alignment:
| Q |
6 |
atttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggtgattgttgtgnnnnnnnattattgtttgg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
31069313 |
atttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggtgtttgttgtg-ttttttattattgtttgg |
31069215 |
T |
|
| Q |
106 |
tcgatattgagatctagtg |
124 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31069214 |
tcgatattgagatctagtg |
31069196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 183 - 253
Target Start/End: Complemental strand, 31069137 - 31069067
Alignment:
| Q |
183 |
gaaattataacaaatgggttgaaaaggatttttaatgaaaaggggtgagatttgggtaaatggtgatgatg |
253 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069137 |
gaaattataacaaatgggttgaaaagggtttttaatgaaaaggggtgagatttgggtaaatggtgatgatg |
31069067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 11593041 - 11593109
Alignment:
| Q |
8 |
ttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggt |
76 |
Q |
| |
|
|||||| ||| |||||| ||||||||||||||||| ||||| || |||||| |||| | ||||||||| |
|
|
| T |
11593041 |
ttctttgattctgtctttggtgttttctatgaaaccagaatccatgttggtgtaatcttgttgatgggt |
11593109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 11645078 - 11645010
Alignment:
| Q |
8 |
ttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggt |
76 |
Q |
| |
|
|||||| ||| |||||| ||||||||||||||||| ||||| || |||||| |||| | ||||||||| |
|
|
| T |
11645078 |
ttctttgattctgtctttggtgttttctatgaaaccagaatccatgttggtgtaatcttgttgatgggt |
11645010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University