View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5110_low_69 (Length: 261)

Name: NF5110_low_69
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5110_low_69
NF5110_low_69
[»] chr7 (2 HSPs)
chr7 (6-124)||(31069196-31069313)
chr7 (183-253)||(31069067-31069137)
[»] chr4 (2 HSPs)
chr4 (8-76)||(11593041-11593109)
chr4 (8-76)||(11645010-11645078)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 6 - 124
Target Start/End: Complemental strand, 31069313 - 31069196
Alignment:
6 atttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggtgattgttgtgnnnnnnnattattgtttgg 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||       ||||||||||||    
31069313 atttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggtgtttgttgtg-ttttttattattgtttgg 31069215  T
106 tcgatattgagatctagtg 124  Q
    |||||||||||||||||||    
31069214 tcgatattgagatctagtg 31069196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 183 - 253
Target Start/End: Complemental strand, 31069137 - 31069067
Alignment:
183 gaaattataacaaatgggttgaaaaggatttttaatgaaaaggggtgagatttgggtaaatggtgatgatg 253  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
31069137 gaaattataacaaatgggttgaaaagggtttttaatgaaaaggggtgagatttgggtaaatggtgatgatg 31069067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 11593041 - 11593109
Alignment:
8 ttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggt 76  Q
    |||||| ||| |||||| |||||||||||||||||  ||||| || |||||| |||| | |||||||||    
11593041 ttctttgattctgtctttggtgttttctatgaaaccagaatccatgttggtgtaatcttgttgatgggt 11593109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 11645078 - 11645010
Alignment:
8 ttctttcattttgtcttcggtgttttctatgaaacttgaatcgatattggtgaaatcatcttgatgggt 76  Q
    |||||| ||| |||||| |||||||||||||||||  ||||| || |||||| |||| | |||||||||    
11645078 ttctttgattctgtctttggtgttttctatgaaaccagaatccatgttggtgtaatcttgttgatgggt 11645010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University