View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5110_low_75 (Length: 252)

Name: NF5110_low_75
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5110_low_75
NF5110_low_75
[»] chr7 (1 HSPs)
chr7 (1-239)||(32413709-32413947)
[»] chr8 (1 HSPs)
chr8 (54-95)||(27701805-27701846)


Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 32413709 - 32413947
Alignment:
1 ttccatcccttgcgttaaggtcttcagactttagaaatgtcaagagattcgcgaaattcgtgtctcgagttttgtctcttcgaaatgactcaacctcatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32413709 ttccatcccttgcgttaaggtcttcagactttagaaatgtcaagagattcgcgaaattcgtgtctcgagttttgtctcttcgaaatgactcaacctcatt 32413808  T
101 gcatactgtggatttttgccgcactgcaatcgtagagccttacctactnnnnnnnnttgtaaaatatgctgtttcgcacaacgtccagcaattagatata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||| ||    
32413809 gcatactgtggatttttgccgcactgcaatcgtagagccttacctactcaaaaaaattgtaaaatatgctgtttcgcacaacgtccagcaattagatgta 32413908  T
201 tctgttgctggtaatatggaatactttccacctagtttc 239  Q
    |||||||||||||||||||||||||||||||||||||||    
32413909 tctgttgctggtaatatggaatactttccacctagtttc 32413947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 54 - 95
Target Start/End: Complemental strand, 27701846 - 27701805
Alignment:
54 aaattcgtgtctcgagttttgtctcttcgaaatgactcaacc 95  Q
    |||||||||||||| ||||||||||||||  |||||||||||    
27701846 aaattcgtgtctcgggttttgtctcttcgcgatgactcaacc 27701805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University