View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_75 (Length: 252)
Name: NF5110_low_75
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 32413709 - 32413947
Alignment:
| Q |
1 |
ttccatcccttgcgttaaggtcttcagactttagaaatgtcaagagattcgcgaaattcgtgtctcgagttttgtctcttcgaaatgactcaacctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32413709 |
ttccatcccttgcgttaaggtcttcagactttagaaatgtcaagagattcgcgaaattcgtgtctcgagttttgtctcttcgaaatgactcaacctcatt |
32413808 |
T |
 |
| Q |
101 |
gcatactgtggatttttgccgcactgcaatcgtagagccttacctactnnnnnnnnttgtaaaatatgctgtttcgcacaacgtccagcaattagatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32413809 |
gcatactgtggatttttgccgcactgcaatcgtagagccttacctactcaaaaaaattgtaaaatatgctgtttcgcacaacgtccagcaattagatgta |
32413908 |
T |
 |
| Q |
201 |
tctgttgctggtaatatggaatactttccacctagtttc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32413909 |
tctgttgctggtaatatggaatactttccacctagtttc |
32413947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 54 - 95
Target Start/End: Complemental strand, 27701846 - 27701805
Alignment:
| Q |
54 |
aaattcgtgtctcgagttttgtctcttcgaaatgactcaacc |
95 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
27701846 |
aaattcgtgtctcgggttttgtctcttcgcgatgactcaacc |
27701805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University