View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_84 (Length: 247)
Name: NF5110_low_84
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_84 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 14 - 247
Target Start/End: Original strand, 32664292 - 32664525
Alignment:
| Q |
14 |
aaatccaacagatccaatgattgcaccaaccttaccaacagccccagaaataccatgacatgttgacctgaacctagctggaaagagttcagctgggaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32664292 |
aaatccaacagatccaatgattgcaccaaccttaccaacagccccagaaataccatgacatgttgacctgaacctagctggaaagagttcagctgggaca |
32664391 |
T |
|
| Q |
114 |
ataaaggtggtagtgttaggtacaaaatttgcaaagaagaaagcaagaccatagataaccatgaaccctttgttatcatgattttctcctttggtccaat |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32664392 |
ataaaggtggtagtgttaggtccaaaatttgcaaagaagaaagcaagaccatagataaccatgaaacctttgttatcatgattttctcctttggtccaat |
32664491 |
T |
|
| Q |
214 |
gagagtaatagggaaaccctaaagcaaaaaatga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32664492 |
gagagtaatagggaaaccctaaagcaaaaaatga |
32664525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University