View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5110_low_9 (Length: 519)
Name: NF5110_low_9
Description: NF5110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5110_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 282 - 502
Target Start/End: Original strand, 45077171 - 45077391
Alignment:
| Q |
282 |
gaattaggttggacggaagccattggcgtgtgttttgggagtaccaaatcacatgacatatgcggatttttgtcagttttgtggttcttttattcagcat |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45077171 |
gaattaggttggacggaagccattggcgtgtgttttgggagtaccaaatcacatgacatatgctgatttttgtcagttttgtggttcttttattcagcat |
45077270 |
T |
 |
| Q |
382 |
attcttgaaatgcgtattgttagaatggaatccatggaagatcgttacagtgttttgattcgcttcgatgaacaagattctacggatgctttctatactc |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45077271 |
attcttgaaatgcgtattgttagaatggaatccatggaagatcgttacagtgttttgattcgcttcgatgaacaagattctacggatgctttctatactc |
45077370 |
T |
 |
| Q |
482 |
attacaatggtcgacgttttt |
502 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45077371 |
attacaatggtcgacgttttt |
45077391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 125 - 215
Target Start/End: Original strand, 45077004 - 45077094
Alignment:
| Q |
125 |
ggaaaccctagaatcgaagaaactcgcggcctcatgcatgtcttccccgaacaaaaccctccttctcttccggtaagcatgatcaatcatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45077004 |
ggaaaccctagaatcgaagaaactcgcggcctcatgcatgtcttccccgaacaaacccctccttctcttccggtaagcatgatcaatcatg |
45077094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 45076888 - 45076964
Alignment:
| Q |
9 |
acatcatcatatttgagttgagcagcgtaccgatgtggagttcaagcagagtcgtctccgaagaagaacaaactgaa |
85 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45076888 |
acataatcatatttgagttgagcagcgtaccgatgtggagttcaagcagagtcgtctccgaagaagaacaaactgaa |
45076964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University