View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5111_high_16 (Length: 285)
Name: NF5111_high_16
Description: NF5111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5111_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 39370693 - 39370926
Alignment:
| Q |
12 |
aagaactgctgatggagatgaaggtggcaagcatcagataattagagcaactgtgaaagatggaaaattatacatttgcaaagctcaagctggagacaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39370693 |
aagaactgctgatggagatgaaggtggcaagcatcagataattagagcaactgtgaaagatggaaaattatacatttgcaaagctcaagctggagacaag |
39370792 |
T |
 |
| Q |
112 |
aggtggtttaaaggagcaagaagatttgtggagagtacagcaaattctttcagtgttgcttaagaacttaatagagggttataaattatattacatgtag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39370793 |
aggtggtttaaaggagcaagaagatttgtggagagtacagcaaattctttcagtgttgcttaagaacttaatagagggttataaattatattacatgtag |
39370892 |
T |
 |
| Q |
212 |
tgcatgtaaatcaacttcaagtgctatgtatttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39370893 |
tgcatgtaaatcaacttcaagtgctatgtatttt |
39370926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 39371146 - 39371183
Alignment:
| Q |
158 |
ctttcagtgttgcttaagaacttaatagagggttataa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39371146 |
ctttcagtgttgcttaagaacttaatagatggttataa |
39371183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 266
Target Start/End: Original strand, 39371120 - 39371149
Alignment:
| Q |
237 |
atgtatttttgacttttctagagtcccttt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39371120 |
atgtatttttgacttttctagagtcccttt |
39371149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 16 - 170
Target Start/End: Original strand, 17105574 - 17105728
Alignment:
| Q |
16 |
actgctgatggagatgaaggtggcaagcatcagataattagagcaactgtgaaagatggaaaattatacatttgcaaagctcaagctggagacaagaggt |
115 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||| | |||| ||||||||| || ||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17105574 |
actgctgatggcgatgaaggtggaaagcaccagctgattacagcaactgtaaatgatggaaaactatacatttgcaaggctcaagctggagacaagaggt |
17105673 |
T |
 |
| Q |
116 |
ggtttaaaggagcaagaagatttgtggagagtacagcaaattctttcagtgttgc |
170 |
Q |
| |
|
||||||| |||||||||| ||||| ||| || |||| ||||||||||||||| |
|
|
| T |
17105674 |
ggtttaagggagcaagaaagtttgttgaggacactgcaagttctttcagtgttgc |
17105728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University