View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5111_high_27 (Length: 211)
Name: NF5111_high_27
Description: NF5111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5111_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 18931566 - 18931462
Alignment:
| Q |
16 |
actacttatatatatagcttgctgttgaaggaacaaacaacgttgccaaaccctttcttccacaatatataagttgagagaaaatagggttttctcagtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| || || |||||||||| |
|
|
| T |
18931566 |
actacttatatatatagcttgctgttgaaggaacaaacaacgttgccaaaccctttcttccacagtatataacttgagagaaatta-ggctttctcagtc |
18931468 |
T |
|
| Q |
116 |
agtgaa |
121 |
Q |
| |
|
||||| |
|
|
| T |
18931467 |
ggtgaa |
18931462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 127 - 188
Target Start/End: Original strand, 40545760 - 40545821
Alignment:
| Q |
127 |
agaacctgtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcactc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40545760 |
agaacctgtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcactc |
40545821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 187
Target Start/End: Original strand, 31790151 - 31790204
Alignment:
| Q |
134 |
gtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcact |
187 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
31790151 |
gtgaccagattgaaacttttgttgctattagatttttgttgtgttctcttcact |
31790204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 187
Target Start/End: Original strand, 32033461 - 32033514
Alignment:
| Q |
134 |
gtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcact |
187 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
32033461 |
gtgaccagattgaaacttttgttgctattagatttttgttgtgttctcttcact |
32033514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 127 - 188
Target Start/End: Original strand, 5163014 - 5163075
Alignment:
| Q |
127 |
agaacctgtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcactc |
188 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5163014 |
agaacttgtgaccagattgaaaattttgttgctattagatttctgtttagttcgcttcactc |
5163075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University