View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5111_low_24 (Length: 246)
Name: NF5111_low_24
Description: NF5111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5111_low_24 |
 |  |
|
| [»] scaffold0014 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0014 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 72978 - 72809
Alignment:
| Q |
1 |
tcaaaatcatgaattcagtataatgctaactcagcttcataagtgtgcattaatttgagatgataactgagcaaacttccgatattccatgtacttggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
72978 |
tcaaaatcatgaattcagtataatgctaacccagcttcataagtgtgcattaatttgagatgataactgagcaaacttccgatattccatgtacttggat |
72879 |
T |
 |
| Q |
101 |
cacattcatcttgaatcctattcacaccacttcaagtcaagtgttaaagtgagagctgctttgaatttta |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
72878 |
cacattcatcttgaatcctattcacaccacttcaagtcaagtgttaaagtgagagctgctttgaatttta |
72809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 242
Target Start/End: Complemental strand, 66648 - 66543
Alignment:
| Q |
136 |
gtcaagtgttaaagtgagagctgctttgaattttatatacattaacagaagtgagaacttttttatgtaccgcttttcttggctttttaaggtttagaag |
235 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
66648 |
gtcaagtgttaaagtgagagctgttttgaattttatattcatcaacagaagtgaggacttttttatgtacc-cttttcttggctttttaaggtttagaag |
66550 |
T |
 |
| Q |
236 |
aataatt |
242 |
Q |
| |
|
||||||| |
|
|
| T |
66549 |
aataatt |
66543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 209 - 240
Target Start/End: Complemental strand, 31987190 - 31987159
Alignment:
| Q |
209 |
ttttcttggctttttaaggtttagaagaataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31987190 |
ttttcttggctttttaaggtttagaagaataa |
31987159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University