View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5111_low_25 (Length: 233)
Name: NF5111_low_25
Description: NF5111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5111_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 30695622 - 30695420
Alignment:
| Q |
16 |
atgaagaagctatgctggtgttgagaagtggagcttatagtactcaatcagatggtgatttcgaaataaactcatcagatgtatggtgatgctggaggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30695622 |
atgaagaagctatgctggtgttgagaagtggagcttatagtactcaatcagatggtgatttcgaaataaactcatcagatgtatggtgatgctggaggtt |
30695523 |
T |
|
| Q |
116 |
cgttggggtaatctgatgctgctggttctggttattgtgtattgggtgagttgagatgtggttgccacttgacctttatttatcaattatcatgtgtatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30695522 |
cgttggggtaatctgatgctgctggttctggttattgtgtattgggtgagttgagatgtggttgccacttgacctttatttatcaattatcatgtgtatc |
30695423 |
T |
|
| Q |
216 |
tta |
218 |
Q |
| |
|
||| |
|
|
| T |
30695422 |
tta |
30695420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University