View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5113-Insertion-6 (Length: 302)
Name: NF5113-Insertion-6
Description: NF5113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5113-Insertion-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 154 - 270
Target Start/End: Original strand, 3478423 - 3478540
Alignment:
| Q |
154 |
tattatatttgatgactattaaaagttctgaatattatttatgaatttggagnnnnnnnnctacgtaga-tttgactttaataatacaaaactaacatcc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
3478423 |
tattatatttgatgactattaaaagttctgaatattatttagtaatttggagaaaaaaaactatttagattttgactttaataatacaaaattaacatcc |
3478522 |
T |
 |
| Q |
253 |
tttatacaaccaaacact |
270 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3478523 |
tttatacaaccaaacact |
3478540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University