View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5113_high_6 (Length: 243)
Name: NF5113_high_6
Description: NF5113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5113_high_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 15419139 - 15419365
Alignment:
| Q |
17 |
agctttagggacatcaattgttgtatccggcggtaaaactccgccatttttctccttaactaactgtttttctttcttctcttccctgctgttatacatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15419139 |
agctttagggacatcaattgttgtatccggtggtaaaactccgccatttttctccttaactaactgtttttctttcttctcttccctgctgttatacatt |
15419238 |
T |
 |
| Q |
117 |
ttacatcttttctttattacctcaggaagtccattgattctcactttaaattcatcatattctctcttcatccatctcctatcttttacaaaatcatgtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15419239 |
ttacatcttttctttattacctcaggtagtccattgattctcactttaaattcatcatattctctcttcatccatctcctatcttttacaaaatcatgtc |
15419338 |
T |
 |
| Q |
217 |
ttttcttgttctttgtaggatctttct |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15419339 |
ttttcttgttctttgtaggatctttct |
15419365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University