View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5113_low_9 (Length: 216)
Name: NF5113_low_9
Description: NF5113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5113_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 31739004 - 31738863
Alignment:
| Q |
1 |
acaatccaaagttataaaattttaattagatcaaacataaattctaagacagagtgcattgatagtgatcaagtgcctgtactgaagttcaaccaataga |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31739004 |
acaattcaaagttataaaattttaattagatcaaacttaaattctaagatagagtgcattgatagtgatcaagtgcctgtactgaagttcaaccaataga |
31738905 |
T |
 |
| Q |
101 |
aatcttattttttcttcttaacaaaacatctggaaatggaaa |
142 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
31738904 |
aatcttgttttttcttcttaacaaaacttctcgaaatggaaa |
31738863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 216
Target Start/End: Complemental strand, 31738822 - 31738789
Alignment:
| Q |
183 |
tatgtacaaccttatggaagaagagtgaacacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31738822 |
tatgtacaaccttatggaagaagagtgaacacaa |
31738789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University