View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5114-Insertion-7 (Length: 134)

Name: NF5114-Insertion-7
Description: NF5114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5114-Insertion-7
NF5114-Insertion-7
[»] chr2 (1 HSPs)
chr2 (7-134)||(4569776-4569903)


Alignment Details
Target: chr2 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 4569776 - 4569903
Alignment:
7 agatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacggtggcgtgaatgagaggaacgctgtcttggcttttggagcagaagagttcg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
4569776 agatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacggtggcgtggatgagaggaacgctgtcttggcttttggagcagaagagttcg 4569875  T
107 aggcggtggttgtggtagcggagtgtgg 134  Q
    ||||||||||||||||||||||||||||    
4569876 aggcggtggttgtggtagcggagtgtgg 4569903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University