View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5114-Insertion-7 (Length: 134)
Name: NF5114-Insertion-7
Description: NF5114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5114-Insertion-7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 4569776 - 4569903
Alignment:
| Q |
7 |
agatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacggtggcgtgaatgagaggaacgctgtcttggcttttggagcagaagagttcg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569776 |
agatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacggtggcgtggatgagaggaacgctgtcttggcttttggagcagaagagttcg |
4569875 |
T |
 |
| Q |
107 |
aggcggtggttgtggtagcggagtgtgg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4569876 |
aggcggtggttgtggtagcggagtgtgg |
4569903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University