View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5114_low_5 (Length: 203)
Name: NF5114_low_5
Description: NF5114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5114_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 39693025 - 39693203
Alignment:
| Q |
18 |
gtggctgcttttgttggtgtggttgttttttggtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttgggacgtgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693025 |
gtggctgcttttgttggtgtggttatttttttgtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttgggacgtgttt |
39693124 |
T |
 |
| Q |
118 |
ttgttgcatctgttcgtaggtggaagtgtaagctctcatctagagttgaggattactatactaccaatggtgatgatgt |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693125 |
ttgttgcatctgttcgtaagtggaagtgtaagctctcatctagagttgaggattactatactaccaatggtgatgatgt |
39693203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 39702998 - 39703156
Alignment:
| Q |
18 |
gtggctgcttttgttggtgtggttgttttttggtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttgggacgtgttt |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39702998 |
gtggctacttttgttggtgtggttgtttttttgtcgggttatcgattttatcgagccgaaaagcctcaaggaagtgcggttttggatttgggacgtattt |
39703097 |
T |
 |
| Q |
118 |
ttgttgcatctgttcgtaggtggaagtgtaagctctcatctagagttgaggattactat |
176 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39703098 |
ttgttgcatctgttcggaagtggaagtgtaagctctcatctagagttgaggattactat |
39703156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 39930301 - 39930143
Alignment:
| Q |
18 |
gtggctgcttttgttggtgtggttgttttttggtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttgggacgtgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||| || ||||||||| ||||||| ||||||||||||| |
|
|
| T |
39930301 |
gtggctgcttttgttggtgtggttgtttttgtgttaggttatcgattttatcgggccgaaaagccacagggaagtgcgattttggacttgggacgtgttt |
39930202 |
T |
 |
| Q |
118 |
ttgttgcatctgttcgtaggtggaagtgtaagctctcatctagagttgaggattactat |
176 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
39930201 |
ttgttgcatctgctcgtaagtggaggtgtaagctttcatccagagctgaggattactat |
39930143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University