View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5115-Insertion-7 (Length: 297)
Name: NF5115-Insertion-7
Description: NF5115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5115-Insertion-7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 32955860 - 32955629
Alignment:
| Q |
8 |
agaaaatggcattcctaatttcctttcttggagactcaacacaagtcttgttcacgattacacaagatgaagcattggaattagaagttacgatgatatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32955860 |
agaaaatggcattcctaatttcctttcttggagactcaacacaagtcttgttcacgattacacaagatgaagcattggaattagaagttatgatgat--- |
32955764 |
T |
 |
| Q |
108 |
gatgatgatgacgacataagcttaatattcctaagataatagaacagaaagaagacaaaaaatgatgatgtagatgtaggtgtacgacaatgttttacga |
207 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32955763 |
------------gacataagcttaatattcctacgttaatagaacagaaagaagacaaaaaatgatgatgtagatgtaggtgtacgacaatgttttacga |
32955676 |
T |
 |
| Q |
208 |
tgtagatgtttttgattgtgatggttatgttatggtctcgtcaacgg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32955675 |
tgtagatgtttttgattgtgatggttatgttatggtctcgtcaacgg |
32955629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University