View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5115-Insertion-8 (Length: 104)
Name: NF5115-Insertion-8
Description: NF5115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5115-Insertion-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 9 - 104
Target Start/End: Complemental strand, 3361541 - 3361446
Alignment:
| Q |
9 |
cttgaatgtggaatcatgtgttcaagttttgagaattttgaacaccaaggcagatgttgaaattgagaaactcgaaaatgatctcttgtgccttga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361541 |
cttgaatgtggaatcatgtgttcaagttttgagaattttgaacaccaaggcagatgttgaaattgagaaactcgaaaatgatctcttgtgccttga |
3361446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University