View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5115_high_2 (Length: 314)
Name: NF5115_high_2
Description: NF5115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5115_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 27184767 - 27184645
Alignment:
| Q |
9 |
gataattcttggagcttaatttcttaccattttgcagggcatggcctaagattttgtagtgtgcacaatacaagggttactaatcatatttgatagcaac |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27184767 |
gataattctttgagcttaatttcttaccattttgcagggcatggcctaagattttgtagtgtgcacaatacaacggttactaatcatatttgatagcaac |
27184668 |
T |
 |
| Q |
109 |
agggaaggcatgcccctcccttt |
131 |
Q |
| |
|
| |||||||||| |||||||||| |
|
|
| T |
27184667 |
aaggaaggcatgtccctcccttt |
27184645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 20 - 290
Target Start/End: Original strand, 38172615 - 38172887
Alignment:
| Q |
20 |
gagcttaatttcttaccattttgcagggcatggcctaagattttgtagtgtgcacaatacaagggttactaatcatatttgatagcaacagggaaggcat |
119 |
Q |
| |
|
||||||| |||||||| | |||||| || ||| ||||| ||||| ||||||||||||||| ||||| || ||||||| ||||||| ||||||||||| |
|
|
| T |
38172615 |
gagcttactttcttacaactttgcaaggtatgacctaacattttacagtgtgcacaatacatgggtttcttctcatattcaatagcaatagggaaggcat |
38172714 |
T |
 |
| Q |
120 |
gcccctccctttccacaagaacataa-aaaacagtcttccagacatgtccacatccactaacaccatatcgtacaagacaaacaccttagcaagagtaac |
218 |
Q |
| |
|
||||||||||||||| |||||| || ||||| |||||||||||| |||||||||||||||||| || | |||||| ||||||| ||| | ||| | |
|
|
| T |
38172715 |
acccctccctttccactagaacagaatcaaacaatcttccagacatatccacatccactaacaccctaacttacaagtcaaacactctagacaaagtcgc |
38172814 |
T |
 |
| Q |
219 |
ctcatctatagtta-ggggtacatatacctaaagctatctcaaacaacgtcttatgtctccaatactcttgag |
290 |
Q |
| |
|
||| ||||| || | ||||||| |||||| |||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
38172815 |
ctcgtctatggtaagggggtaccaatacctgaagctatctcgaacaacgtcttcttcctccaatactcttgag |
38172887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University