View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5115_low_9 (Length: 245)

Name: NF5115_low_9
Description: NF5115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5115_low_9
NF5115_low_9
[»] chr8 (1 HSPs)
chr8 (1-227)||(32955856-32956085)
[»] chr5 (1 HSPs)
chr5 (9-68)||(7723680-7723739)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 32956085 - 32955856
Alignment:
1 tgaattgaaattgcagtcactatgcaatgcttgtgggattagatacaagaaggaagagagaagagcaaacgccgcggttgccacgacagccgcgactaac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
32956085 tgaattgaaattgcagtcactatgcaatgcttgtgggattagatacaagaaggaagagagaagagcgaacgccgcggttgccacgacagctgcgactaac 32955986  T
101 ggcggcataatggagtcaggaaacttctacagtaacaacaaca---acaattcatggtactcacaaccacagagtcaaatgtatggcaatgagctacgtt 197  Q
    || ||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32955985 ggtggcataatggagtcaggaaacttctacagtaacaacaacaacaacaattcatggtactcacaaccacagagtcaaatgtatggcaatgagctacgtt 32955886  T
198 tcatggatgattcagatgcagaatcagaaa 227  Q
    ||||||||||||||||||||||||||||||    
32955885 tcatggatgattcagatgcagaatcagaaa 32955856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 7723680 - 7723739
Alignment:
9 aattgcagtcactatgcaatgcttgtgggattagatacaagaaggaagagagaagagcaa 68  Q
    |||| |||||| |||||||||| |||||||| |||| |||||||||||||||||||||||    
7723680 aattacagtcattatgcaatgcatgtgggatcagattcaagaaggaagagagaagagcaa 7723739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University