View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5116_high_5 (Length: 238)
Name: NF5116_high_5
Description: NF5116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5116_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 10761035 - 10761252
Alignment:
| Q |
18 |
gtcatgtaccatgcaaaaattggagttgaacgttggtttatttacgataataacagtgacgatgatatagaaaatgtgattgcattcttacaaactgcgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10761035 |
gtcatgtaccatgcaaaaattggagttgaacgttggtttatttacgataataacagtgacgatgatatagaaaatgtgattggattcttacaaactgcgg |
10761134 |
T |
|
| Q |
118 |
gttacaacgtcacatggcatctatgggcatgggtaaaaactcaagaggcagggtttgctcattgtgctctacgggcccaggcctcgtgcgagtgggttgg |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10761135 |
gttacaacgtgacatggcatctatgggcatgggtaaaaactcaagaggcagggtttgctcattgtgctctacgggcccagtcctcgtgcgagtgggttgg |
10761234 |
T |
|
| Q |
218 |
gtttatggacgtggatga |
235 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
10761235 |
gtttattgacgtggatga |
10761252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 98
Target Start/End: Original strand, 16164308 - 16164361
Alignment:
| Q |
45 |
gaacgttggtttatttacgataataacagtgacgatgatatagaaaatgtgatt |
98 |
Q |
| |
|
|||||||||||||| || |||||||| ||||| |||||||| ||||| |||||| |
|
|
| T |
16164308 |
gaacgttggtttatatatgataataatagtgatgatgatattgaaaaagtgatt |
16164361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University