View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5116_high_7 (Length: 218)

Name: NF5116_high_7
Description: NF5116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5116_high_7
NF5116_high_7
[»] chr7 (2 HSPs)
chr7 (130-201)||(775641-775712)
chr7 (18-46)||(775529-775557)


Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 130 - 201
Target Start/End: Original strand, 775641 - 775712
Alignment:
130 gtgatcctaaaatatacaacagaagttattgcatcagtatgaataaaatttcataaacaccgtaattagttc 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
775641 gtgatcctaaaatatacaacagaagttattgcatcagtatgaataaaatttcataaacaccgtaattagttc 775712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 775529 - 775557
Alignment:
18 aattaagaaatcagattatgacttatctg 46  Q
    |||||||||||||||||||||||||||||    
775529 aattaagaaatcagattatgacttatctg 775557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University