View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5116_high_7 (Length: 218)
Name: NF5116_high_7
Description: NF5116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5116_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 130 - 201
Target Start/End: Original strand, 775641 - 775712
Alignment:
| Q |
130 |
gtgatcctaaaatatacaacagaagttattgcatcagtatgaataaaatttcataaacaccgtaattagttc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
775641 |
gtgatcctaaaatatacaacagaagttattgcatcagtatgaataaaatttcataaacaccgtaattagttc |
775712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 775529 - 775557
Alignment:
| Q |
18 |
aattaagaaatcagattatgacttatctg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
775529 |
aattaagaaatcagattatgacttatctg |
775557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University