View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5116_low_5 (Length: 238)

Name: NF5116_low_5
Description: NF5116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5116_low_5
NF5116_low_5
[»] chr2 (1 HSPs)
chr2 (18-235)||(10761035-10761252)
[»] chr5 (1 HSPs)
chr5 (45-98)||(16164308-16164361)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 10761035 - 10761252
Alignment:
18 gtcatgtaccatgcaaaaattggagttgaacgttggtttatttacgataataacagtgacgatgatatagaaaatgtgattgcattcttacaaactgcgg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
10761035 gtcatgtaccatgcaaaaattggagttgaacgttggtttatttacgataataacagtgacgatgatatagaaaatgtgattggattcttacaaactgcgg 10761134  T
118 gttacaacgtcacatggcatctatgggcatgggtaaaaactcaagaggcagggtttgctcattgtgctctacgggcccaggcctcgtgcgagtgggttgg 217  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
10761135 gttacaacgtgacatggcatctatgggcatgggtaaaaactcaagaggcagggtttgctcattgtgctctacgggcccagtcctcgtgcgagtgggttgg 10761234  T
218 gtttatggacgtggatga 235  Q
    |||||| |||||||||||    
10761235 gtttattgacgtggatga 10761252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 98
Target Start/End: Original strand, 16164308 - 16164361
Alignment:
45 gaacgttggtttatttacgataataacagtgacgatgatatagaaaatgtgatt 98  Q
    |||||||||||||| || |||||||| ||||| |||||||| ||||| ||||||    
16164308 gaacgttggtttatatatgataataatagtgatgatgatattgaaaaagtgatt 16164361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University