View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5116_low_9 (Length: 206)
Name: NF5116_low_9
Description: NF5116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5116_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 9072841 - 9073009
Alignment:
| Q |
18 |
ccttgaaggatatcaaggtcgatgacatggacacgctcttccgcctcaaacgcctcgaaaatggcttggttagcggtaaagtgtgcgaatttgatgtaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072841 |
ccttgaaggatatcaaggtcgatgacatggacacgctcttcagcctcaaacgcctcgaaaatggcttggttagcggtaaagtgtgcgaatttgatgtaag |
9072940 |
T |
 |
| Q |
118 |
ggcaagcttggtagacaatttggtatatcttgaggacttccatagggtttgatgggaaggtagataaac |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072941 |
ggcaagcttggtagacaatttggtatatcttgaggacttccatagggtttgatgggaaggtagataaac |
9073009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University