View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5117-Insertion-3 (Length: 395)
Name: NF5117-Insertion-3
Description: NF5117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5117-Insertion-3 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 206 - 395
Target Start/End: Complemental strand, 5714125 - 5713936
Alignment:
| Q |
206 |
agtccaaatggaatatcctattacaccatgcaatatcaagtttatttggagtgtcatcaaaattcaaaataaaacaatttattgctgccattcagtagtt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714125 |
agtccaaatggaatatcctattacaccatgcaatatcaagtttatttggagtgtcatcaaaattcaaaataaaacaatttattgctgccattcagtagtt |
5714026 |
T |
|
| Q |
306 |
ggctacatacataccggtctttgctcaaaaggaacttcaatttccaacccaggatcccagctacctcctgaagatccacttgtttctcca |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714025 |
ggctacatacataccggtctttgctcaaaaggaacttcaatttccaacccaggatcccagctacctcctgaagatccacttgtttctcca |
5713936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 6 - 101
Target Start/End: Complemental strand, 5714324 - 5714229
Alignment:
| Q |
6 |
cagggatatgaaactcactaactgtcatgctttctgatggctaggctcagccatgaaattcaatattcatactctaatattacacataattcaata |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714324 |
cagggatatgaaactcactaactgtcatgctttctgatggctaggttcagccatgaaattcaatattcatactctaatattacacataattcaata |
5714229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University