View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5117-Insertion-4 (Length: 98)
Name: NF5117-Insertion-4
Description: NF5117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5117-Insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 3e-42; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 7 - 97
Target Start/End: Complemental strand, 12007931 - 12007841
Alignment:
| Q |
7 |
aggagcttcagatcctgttaggttagcactacttcccaatggtagtccatctggccttttctatagccagaaggaagtctcttcgttttga |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12007931 |
aggagctgcagatcctgttaggttagcactacttcccaatggtagtccatctggccttttctatagccagaaggaagtctcttcgttttga |
12007841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 9e-24
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 11996194 - 11996123
Alignment:
| Q |
7 |
aggagcttcagatcctgttaggttagcactacttcccaatggtagtccatctggccttttctatagccagaa |
78 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
11996194 |
aggagctacaaatcctgttaggttagcactacttcccaaaggtagtccatctggccttttctatagtcagaa |
11996123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.000000000000008
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 12002694 - 12002626
Alignment:
| Q |
18 |
atcctgttaggttagcactacttcccaatggtagtccatctggccttttctatagccagaaggaagtct |
86 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||| ||| ||||| || ||| ||||||| |
|
|
| T |
12002694 |
atcctgttaggttagcactgcttcccaatggtagtccatccggcgtttactatatccggaatgaagtct |
12002626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 11986634 - 11986590
Alignment:
| Q |
18 |
atcctgttaggttagcactacttcccaatggtagtccatctggcc |
62 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
11986634 |
atccggttaggttagcattacttcccagcggtagtccatctggcc |
11986590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University