View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5117_low_1 (Length: 250)
Name: NF5117_low_1
Description: NF5117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5117_low_1 |
 | |
|
| [»] scaffold0188 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0188 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 8020 - 8247
Alignment:
| Q |
13 |
atgaatattccacactatatgccaattcaatt----aattgttcaaatcatattaattaggataaataataactgcaaaagatttcaataaagtgtgacg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8020 |
atgaatattccacactatatgccaattcaattaattaattgttcaaatcatattaattaggataaataataactgcacaagatttcaataaagtgtgacg |
8119 |
T |
|
| Q |
109 |
ttgagatatatactcattagggtatttgagttttgagaag-nnnnnnnnnnnnnntgcgtccgtttcaaagattatcattgtctagttttttattattat |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8120 |
ttgagatatatactcattagggtctttgagttttgagaagaaaaaaaataaaaaatgcgtccgtttcaaagattatcattttctagttttttattattat |
8219 |
T |
|
| Q |
208 |
cactatgtttggttttgaatttggtgtt |
235 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
8220 |
cactaggtttggttttgaatttggtgtt |
8247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University