View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118-Insertion-9 (Length: 137)
Name: NF5118-Insertion-9
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118-Insertion-9 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 1e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 6 - 137
Target Start/End: Complemental strand, 43167857 - 43167726
Alignment:
| Q |
6 |
catttccctcttctttttcttcatcttcttctgcttcaataaccactttttctggctccactatcatcaaactattttcttcttcttgatattcattttc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43167857 |
catttccctcttctttttcttcatcttcttctacttcaataaccactttttctggctccactatcatcaaactattttcttcttcttgatattcattttc |
43167758 |
T |
 |
| Q |
106 |
cataacgttatcatcataaattggttctgtaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43167757 |
cataacgttatcatcataaattggttctgtaa |
43167726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 22 - 137
Target Start/End: Original strand, 43154992 - 43155107
Alignment:
| Q |
22 |
ttcttcatcttcttctgcttcaataaccactttttctggctccactatcatcaaactattttcttcttcttgatattcattttccataacgttatcatca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| || || || |||||||| |||||||||| ||| ||||| ||||| ||||||||||| || |
|
|
| T |
43154992 |
ttcttcatcttcttctgcttcaataaccacattttctggttctaccatgatcaaactcttttcttcttgttgggattcactttccgtaacgttatcacca |
43155091 |
T |
 |
| Q |
122 |
taaattggttctgtaa |
137 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43155092 |
ccaattggttctgtaa |
43155107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University