View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118_high_15 (Length: 246)
Name: NF5118_high_15
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 95 - 235
Target Start/End: Original strand, 32223985 - 32224125
Alignment:
| Q |
95 |
atgtttttacaaattatgcttgtctaagtagtaattataattaatcatgacagcttagtgggcgctgttattgactactatctatcaaaaccaacttgct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32223985 |
atgtttttacaaattatgcttgtctaagtagtaattataattaatcatgacagcttagtgggcgctgttattgactactatctatcaaaaccaacttgct |
32224084 |
T |
|
| Q |
195 |
aacaatatttgttttcaaaacaacccgtcactcccattctt |
235 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32224085 |
aacaatatttgttttcaaaacaacctgtcactcccattctt |
32224125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 32223844 - 32223883
Alignment:
| Q |
17 |
gattctattttgtaaagttatagagaacaagtataaaatt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32223844 |
gattctattttgtaaagttatagagaacaagtataaaatt |
32223883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University