View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118_low_18 (Length: 240)
Name: NF5118_low_18
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 33521025 - 33520801
Alignment:
| Q |
18 |
aaaattatcgttataaaaagaaagatcgactctttaaa--cagattaaattcgcttttgatcaggttgtaactttcaatcaactacttttatgtgtaaag |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
33521025 |
aaaaatatcgttataaaaagaaagatcgactctttaaaaacacattaaattcgcttttgatcaggttgtaactttcaatcaactatttttatgtgtagaa |
33520926 |
T |
 |
| Q |
116 |
tttgatcgtatcataccctccaacctacctttttcaacaaagtgagtaattttgaggtgattaaagaacgactatcacaaacgtactacttattagaaat |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
33520925 |
tttgatcgtatcgtaccctccaacctacctttttcaacaaagtgggtaattttgaggtgattaaagaacgactatgacaaacatactacttattagaaat |
33520826 |
T |
 |
| Q |
216 |
gcttcgcaaaaccatgttaaccctt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33520825 |
gcttcgcaaaaccatgttaaccctt |
33520801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University