View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118_low_19 (Length: 240)
Name: NF5118_low_19
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 35368019 - 35367809
Alignment:
| Q |
19 |
ccagtatcatactttgtaaagaaagtttacgggttcagaatatgaaaattattatctccaccagagtatgtataaataattatagtattt-atgtaaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35368019 |
ccagtatcatactttgtaaagaaagtttacgggttcagaatatgaaaattattatctccaccatagtatgtataaataataatagtattttatgtaaaac |
35367920 |
T |
 |
| Q |
118 |
aaacatgaatctcatgacaagtatatattgaactaattttctccctgtgtgttacacatgaggaatataaaacttgtcaatcatccaagcgaacaactta |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35367919 |
aaacatgaatctcatgacaggtatatattgaactaattttctccctgtgtgttacacatgaggaatataaaacttttcaatcatccaagcgaacaactta |
35367820 |
T |
 |
| Q |
218 |
ttttcatctca |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
35367819 |
ttttcatctca |
35367809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University