View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118_low_22 (Length: 205)
Name: NF5118_low_22
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 82 - 186
Target Start/End: Original strand, 37970056 - 37970160
Alignment:
| Q |
82 |
attgatatattttacaagttctagttgtagtaattgcatttcttctatattaaatgtacaggattggaaacagtagaatgtgagatttgtggagagtatt |
181 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
37970056 |
attgatatatttttcaagttctagttgtagtaattgcatttcttctatattaaatgtacaggatttgagacagtagaatgtgagatttgtggagagtatt |
37970155 |
T |
 |
| Q |
182 |
cgagg |
186 |
Q |
| |
|
||||| |
|
|
| T |
37970156 |
cgagg |
37970160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University