View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118_low_6 (Length: 395)
Name: NF5118_low_6
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 17 - 371
Target Start/End: Original strand, 37969581 - 37969944
Alignment:
| Q |
17 |
atggcaaagaagcccgtgaactttgaattggatatgaatcttggtgtcaggatgacggcttcgggactcaaaacatgggttatgacatctcatgttgttt |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969581 |
atggcaaagatgcccgtgaactttgaattggatatgaatcttggtgtgaggatgacggcttcgggactcaaaacatgggttatgacatctcatgttgttt |
37969680 |
T |
|
| Q |
117 |
gtaaatttaaggttaacaatcttgggaaggattcgaaaatcttgtcacaatcatgggttaacagtttcaaacaatattgatgatttatttggatgtatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969681 |
gtaaatttaaggttaacaatcttgggaaggattcgaaaatcttgtcacaatcatgggttaacagtttcaaacaatattgatgatttatttggatgtatat |
37969780 |
T |
|
| Q |
217 |
ggggaatgggatcatcttcaaag-nnnnnnnnncggggagaacgggatcattatggtgttattggaaaatttatttgatgatgaaaa--------catat |
307 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37969781 |
ggggaatgggatcatcttcaaagaaaaaaaaaacggggagaacgggatcattatggtgttattggaaaatttatttgatgatgaaaacatatgttcatat |
37969880 |
T |
|
| Q |
308 |
gttcatgtactttgtagcaacatcaattaaactataaatttatgatccttttgatcttattatc |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969881 |
gttcatgtactttgtagcaacatcaattaaactataaatttatgatccttttgatcttattatc |
37969944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University