View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5118_low_9 (Length: 261)
Name: NF5118_low_9
Description: NF5118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5118_low_9 |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 77 - 245
Target Start/End: Original strand, 15154423 - 15154591
Alignment:
| Q |
77 |
tataaatacagtagtgttcaagttgaacatgattgatatgtggattatagtattatagaagcagctcatcatgaaagagaacatgtcccacattgtacta |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15154423 |
tataaatacagtagtgttcaagttgaacatgattgatatgtggattatagtattatagaagcaggtcatcatgaaagagaacatgtcccacattgtacta |
15154522 |
T |
 |
| Q |
177 |
ctattcctttaccatctcttttattaaattatgtagcagtgagtgagtaatgaattaagaggcaaaaag |
245 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15154523 |
ctattcctttaccttctcttttattaaattatgtagcagtgagtgagtaatgaattaagaggcaaaaag |
15154591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 35
Target Start/End: Complemental strand, 1746940 - 1746909
Alignment:
| Q |
4 |
ttttaagttttagtattctacactttgtatct |
35 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1746940 |
ttttaagttttagtattctacactttgtatct |
1746909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 35
Target Start/End: Complemental strand, 42381855 - 42381824
Alignment:
| Q |
4 |
ttttaagttttagtattctacactttgtatct |
35 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42381855 |
ttttaagttttagtattctacactttgtatct |
42381824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 33
Target Start/End: Complemental strand, 79551 - 79522
Alignment:
| Q |
4 |
ttttaagttttagtattctacactttgtat |
33 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
79551 |
ttttaagttttagtattctacactttgtat |
79522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University